St. Britto Hr. Sec. School - Madurai
12th Biology Monthly Test - 2 ( Zoology - Molecular Genetics )-Aug 2020
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Distinguish between structural gene, regulatory gene and operator gene
-
-
What are the three structural differences between RNA and DNA?
-
A low level of expression of lac operon occurs at all the windows for treatment of various genetic disorders. Justify the statement
-
-
Define a operon.
-
What is reverse pharmacogenomicst?
-
State one gene one enzyme hypothesis
-
Why tRNA is called an adapter molecule?
-
What is a anticodon?
-
It is established that RNA is the first genetic material. Justify giving reasons.
-
Explain the formation of a nucleosome.
-
Name the anticodon required to recognize the following codons: AAU, CGA, UAU, and GCA.
-
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA -
-
Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?
-
How is the two stage process of protein synthesis advantageous?
-